View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19793_low_49 (Length: 210)
Name: NF19793_low_49
Description: NF19793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19793_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 5e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 3094088 - 3093908
Alignment:
| Q |
18 |
cttggaagtagttaaatgttaccaaagggttctcatttggatcggtgtttcggagctccaaatgacccgttgaaattggccccaagattttttctagaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3094088 |
cttggaagtagttaaatgttaccaaagggttctcatttggatcggtgtttcggagctccaaatgacccgttgaaattggccccaagattttttctagaat |
3093989 |
T |
 |
| Q |
118 |
gaatccacccctgaatgcttcttggtccaggctctccatcctctctattgcttttgctatggcttctggggtcctttgctt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3093988 |
gaatccacccctgaatgcttcttggtccaggctctccatcctctctattgcttttgctatggcttctggggtcctttgctt |
3093908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 20 - 182
Target Start/End: Complemental strand, 3085240 - 3085078
Alignment:
| Q |
20 |
tggaagtagttaaatgttaccaaagggttctcatttggatcggtgtttcggagctccaaatgacccgttgaaattggccccaagattttttctagaatga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||| || | | ||| || ||||||| |
|
|
| T |
3085240 |
tggaagtagttaaatgttaccaaagggttatcatttggatcagtgtttcggagctccaaatgacctgttgaaattggacctattactttctccagaatga |
3085141 |
T |
 |
| Q |
120 |
atccacccctgaatgcttcttggtccaggctctccatcctctctattgcttttgctatggctt |
182 |
Q |
| |
|
|||||||||| || ||||||||||| ||||| || |||||| ||||||||||||||||||||| |
|
|
| T |
3085140 |
atccaccccttaaagcttcttggtctaggctttctatcctccctattgcttttgctatggctt |
3085078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University