View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19793_low_6 (Length: 442)
Name: NF19793_low_6
Description: NF19793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19793_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 418; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 418; E-Value: 0
Query Start/End: Original strand, 1 - 422
Target Start/End: Complemental strand, 42150666 - 42150245
Alignment:
| Q |
1 |
atagattttttctttctttgatgttgaggatgatagattttactacatgattttggctataaatgcatatgtattttatcacattatcacccattcaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42150666 |
atagattttttctttctttgatgttgaggatgatagattttactacatgattttggctataaatgcatatgtattttatcacattatcacccattcaatc |
42150567 |
T |
 |
| Q |
101 |
aacaatttaaattggtaactctatgtcttcaaatgaacttctcactttagaagagttaaatccatagaaaacatgtctggtatttattcttcttattctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42150566 |
aacaatttaaattggtaactctatgtcttcaaatgaacttctcactttagaagagttaaatccatagaaaacatgtctggtatttattcttcttattctt |
42150467 |
T |
 |
| Q |
201 |
tttgtgatatgtgcaccatgagctgatatccacttgtttgaaaatgattgcgctgtcaagtatttgggttgcctaagtaagtgctctagattctcatata |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42150466 |
tttgtgatatgtgcaccatgagctgatatccacttgtttgaaaatgattgcgctgtcaagtatttgggttgcctaagtaagtgctctagattctcatata |
42150367 |
T |
 |
| Q |
301 |
ttttattatagcctgttacattaaattgtaattactgacgccatttcacaaaacagaatagtatttatgttgtcccaaattatttgtctttccggttgaa |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42150366 |
ttttattatagcctgttacattaaattgtaattactgacgccatttcacaaaacagaatagtatttatgttgtcccaaattattcgtctttccggttgaa |
42150267 |
T |
 |
| Q |
401 |
aaatataagctaatgtttggca |
422 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42150266 |
aaatataagctaatgtttggca |
42150245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University