View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19794_low_11 (Length: 240)
Name: NF19794_low_11
Description: NF19794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19794_low_11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 22192279 - 22192500
Alignment:
| Q |
19 |
gacgcatcattaccatcttcaacaatgtcacgggattccattttttgttagtaagtgcagatatcttctactttt-tctattgcttttctcaccctcctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22192279 |
gacgcatcattaccatcttcaacaatgtcacgggattccattttttgttagtaagtgaagatatcttctacttttttctattgcttttctcaccctcctt |
22192378 |
T |
 |
| Q |
118 |
tcttcagaaactgatggtatttccttttgtttctttaaatatatggttatcgtgcactatttagggtaacttgcttaggtaagcaaagtgaatcgttcat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
22192379 |
tcttcagaaactgatggtatttccttttgtttctttaaatatatggttatcgtgcactatttagggtaacttgcttagg-aagcaaagcgaatcgttcat |
22192477 |
T |
 |
| Q |
218 |
gtctaatgtttttcccttttcct |
240 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
22192478 |
gtctaatgttttccccttttcct |
22192500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 238
Target Start/End: Original strand, 20016003 - 20016098
Alignment:
| Q |
151 |
tttaaatatatggttatcgtgcactatttagggtaacttgct----------taggtaagcaaagtgaatcgttcatgtctaatgtttttcccttttc |
238 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
20016003 |
tttaaatttatggttatcatgcactatttagggtaacttgctataactttcataggtaagcaaagagaatcgttcatg--taatgtttttcccttttc |
20016098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 229
Target Start/End: Original strand, 20035146 - 20035234
Alignment:
| Q |
151 |
tttaaatatatggttatcgtgcactatttaggg----------taacttgcttaggtaagcaaagtgaatcgttcatgtctaatgtttt |
229 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
20035146 |
tttaaatgtatggttatcgtgcactatttagggtaactcgctataacttgcttaggtcagcaaagggaatcgttcatgtctaatatttt |
20035234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University