View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19794_low_7 (Length: 360)
Name: NF19794_low_7
Description: NF19794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19794_low_7 |
 | |
|
| [»] scaffold0072 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0072 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 47 - 353
Target Start/End: Original strand, 41674 - 41980
Alignment:
| Q |
47 |
gttaaaaacatcactagatctgagatgatgctgagaagagaaaaaagattatgttattattgtgatgaacgattctctatatctcataaatgtccaaatc |
146 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41674 |
gttaaaaacatcactagagctgagatgatgctcagaagagaaaaaggattatgctattattgtgatgaacgattctctatatctcataaatgtccaaatc |
41773 |
T |
|
| Q |
147 |
gtcattatttcttatttcaaactgaagaagaagaagaacctgacccaccaccaccgcaaatcacaccatcagctgaccctgaaacaccacctattgttac |
246 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41774 |
gtcattatttcttattccaaactgaagaagaagaagaacctgaaccaccaccacaacaaatcacaccatcagctgaccctgaaacaccacctattgttac |
41873 |
T |
|
| Q |
247 |
ggaggagcaccacttgtcactgaatgccttgaacggttctgctcgtaaaggcaccatgcggttccacggtcaaattcagggtattgctatcacgatattc |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
41874 |
ggaggagcaccacttgtcactgaatgccttgaacggttctgctcgtaaaggcaccatgcggttccacagtcaaattcagggtattgctatcacgattttg |
41973 |
T |
|
| Q |
347 |
ttggaca |
353 |
Q |
| |
|
||||||| |
|
|
| T |
41974 |
ttggaca |
41980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University