View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19794_low_9 (Length: 258)
Name: NF19794_low_9
Description: NF19794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19794_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 21 - 251
Target Start/End: Original strand, 54542735 - 54542986
Alignment:
| Q |
21 |
taactaccatgaatgaacaaatattggaaagtcgtttaaaaaatgattagtatctaaatatctatattgaccgattatgtggttaccgcaatttcaaaac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54542735 |
taactaccatgaatgaacaaatattggaaagtcgtttaaaaaatgattagtatctaaatatctatatttaccgattatgtggttaccgcaatttcaaaac |
54542834 |
T |
 |
| Q |
121 |
caattcctatgtgtgaagataactgatgaaag---------------------tagtagcagactttacttcatgtaatcatgatttgttcgaccttcac |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54542835 |
caattcctatgtgtgaagataattgatgaaagcaagtaaagtctgctactaattagtagcagactttacttcatgtaatcatgatttgttcgaccttcac |
54542934 |
T |
 |
| Q |
200 |
gcgaaccaattttgttggcttggtggtagaagacctcttaacacctcctttg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54542935 |
gcgaaccaattttgttggcttggtggtagaagacctcttaacacctcctttg |
54542986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University