View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19795_high_10 (Length: 421)
Name: NF19795_high_10
Description: NF19795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19795_high_10 |
 |  |
|
| [»] scaffold0110 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0110 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 19 - 299
Target Start/End: Original strand, 8502 - 8780
Alignment:
| Q |
19 |
tgaaatccatgtgtatcccttcctaacaaacagacatggggttgaggatatattttggcttattttcaacaatctcgtggtggaaggttggctatatctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
8502 |
tgaaatccatgtgtatcccttcctaacaaacagacatggggttgaggatatattttggcttattttcaacaatctcgtggtggaaggttggctacatttg |
8601 |
T |
 |
| Q |
119 |
ctatacaaacgaatactttatattttatgagttatacaaacgtatacatagtacaagcatgtgggaagaaatttgggttacacataataatggttcattg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8602 |
ctatacaaacgaatactttatattttatgagttatacaaacgtatacatagtacaagcatgtgggaagaaatttgggttacacataataatggtccattg |
8701 |
T |
 |
| Q |
219 |
caatatactagctttttcattagcacgtggtgctaccttttaagagattctaaggccatgtatgtattggctaaatttcaa |
299 |
Q |
| |
|
|| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8702 |
ca--atactagcttttccattagcacgtggtgctaccttttaagagattctaaggccatgtatgtattggctaaatttcaa |
8780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 291 - 406
Target Start/End: Original strand, 8964 - 9074
Alignment:
| Q |
291 |
aaatttcaaatatcataatgacatcttaacatttgccattcaaacatatataaatatcataatttaattttaactcttttgaaaaatatactttttattt |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8964 |
aaatttcaaatatcataatgacatcttaacatttgccattcaaacatatataaatatca-----taattttaactcttttgaaaaatataccttttattt |
9058 |
T |
 |
| Q |
391 |
tagtgatcaacctatg |
406 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9059 |
tagtgatcaacctatg |
9074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University