View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19795_high_25 (Length: 258)
Name: NF19795_high_25
Description: NF19795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19795_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 117 - 244
Target Start/End: Complemental strand, 33552704 - 33552578
Alignment:
| Q |
117 |
ataaagtgtgacattactctgctcaattagatcctttgtgttttagatcaatactgcataaatatgaaacttcatggcgagattaagacaatgcagtgag |
216 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33552704 |
ataaagtgtgacattactctcctcaattagatc-tttatgttttagatcaatactgcataaatatgaaacttcatggcgagattaagacaatgcagtgag |
33552606 |
T |
|
| Q |
217 |
tttgaataacaaacaagctccgtaattt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33552605 |
tttgaataacaaacaagctccgtaattt |
33552578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 33553130 - 33553040
Alignment:
| Q |
19 |
cgaaggtccgcagagaagcatgatagcaatgttcaatattcaaggatgttctaagattgaccataaatccgtacattggtttcttctctta |
109 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33553130 |
cgaaggtccacagagaagcatgatagcaatgttcaatattcaaggatgttctaagattgaccataaatccgtacattggtttcttctctta |
33553040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University