View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19795_high_35 (Length: 235)
Name: NF19795_high_35
Description: NF19795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19795_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 16 - 68
Target Start/End: Original strand, 44546841 - 44546893
Alignment:
| Q |
16 |
aagaacgatgtgaatgaggaagaaggtgtttcagctgtgaaagctacatttgt |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546841 |
aagaacgatgtgaatgaggaagaaggtgtttcagctgtgaaagctacatttgt |
44546893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 133 - 179
Target Start/End: Original strand, 44546958 - 44547004
Alignment:
| Q |
133 |
ataattaatgtggaaagcttggtaatatgcaatcttatatttgtcaa |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44546958 |
ataattaatgtggaaagcttggtaatatgcaatcttaaatttgtcaa |
44547004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University