View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19795_high_36 (Length: 234)
Name: NF19795_high_36
Description: NF19795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19795_high_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 388535 - 388735
Alignment:
| Q |
18 |
atgtagtcacttgagaagccataggttagtgtcattggcatgtcgcgtgaccatcgcggttttccaggaaaataaacaaaattcgtcgtgttatgaatat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
388535 |
atgtagtcacttgagaagccataggttagtgtcattggcatgtcgcgtgaccatcgcggttttccaggaaaataaacaaaattcgtcttgttatgaatat |
388634 |
T |
|
| Q |
118 |
gattttgatggtgattatgataatgatgagtttttgttgtgtctggaacaccgcatcttggtgtgatcatttgagaaactgtgttcgaatcgagtttacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
388635 |
gattttgatggtgattatgataatgatgagtttttgttgtgtctggaacaccgcatcttggtgtgatcatttgagaaactgtattcgaatcgagtttacc |
388734 |
T |
|
| Q |
218 |
g |
218 |
Q |
| |
|
| |
|
|
| T |
388735 |
g |
388735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University