View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19795_high_37 (Length: 214)
Name: NF19795_high_37
Description: NF19795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19795_high_37 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 48 - 198
Target Start/End: Complemental strand, 42683544 - 42683394
Alignment:
| Q |
48 |
tcatttagaatttactcttttgctttagaaagtttgatttaagaggcttttcacattacatttcacaaagaggaataacattcctatggggttcagctaa |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| | || |
|
|
| T |
42683544 |
tcatttagaatttactcttttgctttagaaagtttgatttaagaggcttttcgcattacatttcacatagaggaataacattcctatggggttcaaccaa |
42683445 |
T |
|
| Q |
148 |
tgccacatgtccaacatacaaaatggaaggttgcatgtgatgacaagtaac |
198 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
42683444 |
tgtcacatgtccaacatacaaaatgaaaggttgtatgtgatgacaagtaac |
42683394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 196
Target Start/End: Complemental strand, 342810 - 342779
Alignment:
| Q |
165 |
acaaaatggaaggttgcatgtgatgacaagta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
342810 |
acaaaatggaaggttgcatgtgatgacaagta |
342779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 196
Target Start/End: Original strand, 4603273 - 4603304
Alignment:
| Q |
165 |
acaaaatggaaggttgcatgtgatgacaagta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4603273 |
acaaaatggaaggttgcatgtgatgacaagta |
4603304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 196
Target Start/End: Complemental strand, 25857723 - 25857692
Alignment:
| Q |
165 |
acaaaatggaaggttgcatgtgatgacaagta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25857723 |
acaaaatggaaggttgcatgtgatgacaagta |
25857692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 196
Target Start/End: Original strand, 22764075 - 22764106
Alignment:
| Q |
165 |
acaaaatggaaggttgcatgtgatgacaagta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22764075 |
acaaaatggaaggttgcatgtgatgacaagta |
22764106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University