View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19795_high_38 (Length: 213)
Name: NF19795_high_38
Description: NF19795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19795_high_38 |
 |  |
|
| [»] scaffold0224 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0224 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0224
Description:
Target: scaffold0224; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 142 - 200
Target Start/End: Complemental strand, 12060 - 12002
Alignment:
| Q |
142 |
attcttcttctgaattatattggatctattgttatttgtgaactcatgtttctgaatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
12060 |
attcttcttctgaattatattggatctattgttatttgtgaacccatatttctgaatct |
12002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 142 - 200
Target Start/End: Original strand, 42934711 - 42934769
Alignment:
| Q |
142 |
attcttcttctgaattatattggatctattgttatttgtgaactcatgtttctgaatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
42934711 |
attcttcttctgaattatattggatctattgttatttgtgaacccatatttctgaatct |
42934769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 142 - 200
Target Start/End: Complemental strand, 21263402 - 21263344
Alignment:
| Q |
142 |
attcttcttctgaattatattggatctattgttatttgtgaactcatgtttctgaatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||| |
|
|
| T |
21263402 |
attcttcttctgaattatattggatctattgttatttgtgaacccttatttctgaatct |
21263344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University