View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19795_low_18 (Length: 370)
Name: NF19795_low_18
Description: NF19795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19795_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 1e-66; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 158 - 313
Target Start/End: Complemental strand, 31795769 - 31795611
Alignment:
| Q |
158 |
ttaggattcaaattcccctacttgcaaagccctttaaaatcatactctaatgtacaaat---atttacctatccatgtaactctcaaagttctcaagttc |
254 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
31795769 |
ttaggtttcaaattcccctacttgcaaagccctttaaaatcatactctaatgtacaaattatatttacctatccaagtaactctcaaagttctcaggtta |
31795670 |
T |
|
| Q |
255 |
acaatcaacatttaagagttttcaaagaatggaatgtaaaagatgagtttatgagagaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31795669 |
acaatcaacatttaagagttttcaaagaatggaatgtaaaagatgagtttatgagagaa |
31795611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 54 - 102
Target Start/End: Complemental strand, 31796111 - 31796063
Alignment:
| Q |
54 |
ctcattttattcttgagaaggcatcattgatgatgaactgagttgaatg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31796111 |
ctcattttattcttgagaaggcatcattgatgatgaactgagttgaatg |
31796063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 341 - 370
Target Start/End: Complemental strand, 31795439 - 31795410
Alignment:
| Q |
341 |
taaaacgattcactttgtgaaatgattcac |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31795439 |
taaaacgattcactttgtgaaatgattcac |
31795410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 305 - 354
Target Start/End: Original strand, 28103533 - 28103584
Alignment:
| Q |
305 |
atgagagaaacaattcacact--aacaaaaagttatagtaaaacgattcact |
354 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| ||| |||||||||||| |
|
|
| T |
28103533 |
atgagtgaaacaattcacactctaacaaaaagttaaagttaaacgattcact |
28103584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 202 - 284
Target Start/End: Complemental strand, 30267286 - 30267204
Alignment:
| Q |
202 |
ctctaatgtacaaatatttacctatccatgtaactctcaaagttctcaagttcacaatcaacatttaagagttttcaaagaat |
284 |
Q |
| |
|
|||||||||||||| |||||| |||| | |||||||||| |||||||| ||||||| || || |||||||||||||||||| |
|
|
| T |
30267286 |
ctctaatgtacaaagatttacgtatctaactaactctcaaggttctcaaaatcacaatgaatatctaagagttttcaaagaat |
30267204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University