View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19795_low_33 (Length: 249)
Name: NF19795_low_33
Description: NF19795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19795_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 23870587 - 23870363
Alignment:
| Q |
1 |
gtctaatttcgatatatttaggtaaatgcttgcattggtgattctttcttttggaggtgaagttcatcagggattagggtgctttgatcatctcctatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23870587 |
gtctaatttcgatatatttaggtaaatgcttgcattggtgattatttcttttgg--gtgaagttcatcagggattagggtgctttgatcatctcctatta |
23870490 |
T |
|
| Q |
101 |
gcagcagtggctttgaagacagtgttgtcttgatgttgtcttagtcaacgagcctattattagtagaaagaagctgtgttcagaattttcgcctggtgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23870489 |
gcagcagtggctttgaagacagtgttg-----------tcttagtcaacgagcctattattagtagaaagaagctgtgttcagaattttcgcctggtgtg |
23870401 |
T |
|
| Q |
201 |
tgtggctaccttgcagagtatgagtcagttttgcttca |
238 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23870400 |
tgtggcaaccttgcagagtatgagtcagttttgcttca |
23870363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University