View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19795_low_36 (Length: 244)
Name: NF19795_low_36
Description: NF19795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19795_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 3 - 227
Target Start/End: Complemental strand, 28757850 - 28757625
Alignment:
| Q |
3 |
tagggtaggtaagtgttcttctacgatgtttagaaatcactcaactttgacgatgaccgacatggccacctttaattagaagcaaagggttctccacgtc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28757850 |
tagggtaggtaagtgttcttctacgatgtttagaaatcactcaactttgacgatgaccgacatgggcacctttaattagaagcaaagggttctccacgtc |
28757751 |
T |
|
| Q |
103 |
tttacgactgagacaccgacctgatcgatattgatttgag-nnnnnnnnncagaatgaatataagttgagttttgagctattcatactcgttttccttgt |
201 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28757750 |
tttacgactgagacactgacctgatcgatattgatttgagaaaaaaaaaacagaatgaatataagttgagttttgagctattcatactcgttttccttgt |
28757651 |
T |
|
| Q |
202 |
tttgtttttctcgaaccgaccctgat |
227 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
28757650 |
tttgtttttctcgaaccgacactgat |
28757625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University