View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19795_low_44 (Length: 203)
Name: NF19795_low_44
Description: NF19795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19795_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 9 - 186
Target Start/End: Original strand, 14309396 - 14309578
Alignment:
| Q |
9 |
tccaagaatatgaatcccacgtatactccaccaaccata----gttgagcctttggcatgcctagtcatttaaaa-ctttcaaaaaagcaggcagataag |
103 |
Q |
| |
|
||||| ||| ||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
14309396 |
tccaacaatgtgaatcccatgtatactccaccaaaaatatatagttgagcctttggcatgcctagtcatttaaaaactttcaaaaaatcaggcagataag |
14309495 |
T |
 |
| Q |
104 |
ttcacttttccacaacaaaaataagagatctttgcgggaagagaacaatccaagtgtatgttatgattagtggctgcgagact |
186 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14309496 |
ttcattttgccacaacaaaaataagagatctttgcgggaagagaacaatccaagtgtatgttatgattagtggctgcgagact |
14309578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University