View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19796_low_9 (Length: 223)
Name: NF19796_low_9
Description: NF19796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19796_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 40978509 - 40978410
Alignment:
| Q |
1 |
ttgcagaaaaggaaaattaactgatgcctgataatgcaagtctgattaatttacgatgccgttaaacacttgaggagagctaattaatcttgaggtacta |
100 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40978509 |
ttgcagaataggaaaattaactgatgcttgataatgtaattatgattaatttacgatgccgttaaacacttgaggagagctaattaatcttgaggtacta |
40978410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 118 - 223
Target Start/End: Complemental strand, 40977479 - 40977374
Alignment:
| Q |
118 |
taaaatgaccattatgacacttgaattaattnnnnnnnnnnnnntaagtcctctttccaatatatgaaaaagaattttgagaagagaagaaaggttctgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40977479 |
taaaatgaccattatgacacttgaattaattaaaaaaaaaaaaaaaagtcctctttccaatatatgaaaaagaattttgagaagagaagaaaggttctgt |
40977380 |
T |
 |
| Q |
218 |
tgtttt |
223 |
Q |
| |
|
|||||| |
|
|
| T |
40977379 |
tgtttt |
40977374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 30 - 59
Target Start/End: Original strand, 40981713 - 40981742
Alignment:
| Q |
30 |
gataatgcaagtctgattaatttacgatgc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40981713 |
gataatgcaagtctgattaatttacgatgc |
40981742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University