View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19797_high_8 (Length: 252)
Name: NF19797_high_8
Description: NF19797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19797_high_8 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 9 - 252
Target Start/End: Original strand, 29136108 - 29136349
Alignment:
| Q |
9 |
gattatacttgtgattacactt-gtgatggtaataaattatttgaagggatagaaagagttcaactttaggttgttggggtggaataaacaagtcagtca |
107 |
Q |
| |
|
||||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29136108 |
gattaaacttgtgattacgctttgtgatggtaataaattatttgaagggatagaaagagttcaactttaggttgttggggtggaataaacaagtcagtca |
29136207 |
T |
 |
| Q |
108 |
aattaaattagtgttgttttgagtcaannnnnnnnnnnnnnnnnnnngtctaagtaaagcacaagttagcaacatcgtgtggtcgatccaagtggtaaga |
207 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29136208 |
aattaaattagtgttgttttgagtcaa--ttttttttctttttttttgtctaagtaaagcacaagttagcaacatcgtgt-gtcgatccaagtggtaaga |
29136304 |
T |
 |
| Q |
208 |
gactcgggcaccttaagtaggtggtcagtagtacaatctctgact |
252 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29136305 |
gactcgagcaccttaagtaggtggtcagtagttcaatctctgact |
29136349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University