View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19797_low_4 (Length: 515)
Name: NF19797_low_4
Description: NF19797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19797_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 475; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 475; E-Value: 0
Query Start/End: Original strand, 1 - 499
Target Start/End: Original strand, 35043879 - 35044377
Alignment:
| Q |
1 |
ttctcaaatgaaaggttggagatattattattgacattaagcaaattttgttctttgggtggtgacccaccatttgtgacaatcttatcacacaccacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35043879 |
ttctcaaatgaaaggttggagatattattattgacattaagcaaattttgttctttggatggtgacccaccatttgtgacaatcttatcacacaccacta |
35043978 |
T |
|
| Q |
101 |
ctgaacaaggatcagatactgattcactcaagcattcatttttagaactgatcataactttctcagaatttgcctaaacagagggtgcagatgagcactc |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
35043979 |
ctgaacaaggatcagttactgattcactcaagcattcatttttagaactgatcatagctttctcagaatttgcctcaacagagggtgcagataagcactc |
35044078 |
T |
|
| Q |
201 |
atgtgccatttcttttgcatccaattgcattggcgattcagaggagtcttggaaagatggcaattttagccggcagccatgagatgacatattagcagga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35044079 |
atgtgccatttcttttgcatccaattgcattggcgattcagaggagtcttggaaagatggcaattttggccggcagccatgagatgacatattagcagga |
35044178 |
T |
|
| Q |
301 |
tttactgagatgttgttttccaaaatattcaagtcaactttgtcatggatagagccactgactgtcatttgtctgttaatagaagcttcttcactttgag |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35044179 |
tttactgagatgttgttttccaaaatattcaagtcaactttgtcatggatagagccactgactgtcatttgtctgttaatagaagcttcttcactttgag |
35044278 |
T |
|
| Q |
401 |
atggcaaaggaagttggaactcctttgcatataaatctgcctcttcatttttatgatgggcctgatcaccagatgtacctgtaaaatcagcaagcactt |
499 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35044279 |
atggcaaaggaagttggaactcctttgcatataaatctgcctcttcatttttatgatgggcctgatcaccagatgtacctgtaaaatcagcaagcactt |
35044377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University