View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19798_low_11 (Length: 259)
Name: NF19798_low_11
Description: NF19798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19798_low_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 259
Target Start/End: Complemental strand, 733256 - 733026
Alignment:
| Q |
19 |
cacaaaagggtgattatatgtgccacttcctttaacaatactcattctctagtatgaaatcaaaacatatagtacaaaaagatatttttggtaactctat |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
733256 |
cacaaaagggtgattatatttgccacttcctttaacaatattcattctctagtatgaaatcaaaacatatagtacaaaaagatatttttggtaactctat |
733157 |
T |
 |
| Q |
119 |
agagtatagtagaactctcataaccagcctcgatgcatgctattgttgctgctttcccactcttcttcttttcatcatacatgagcactaataagttcat |
218 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
733156 |
ag-------tagaactctcataaccagcctcgatg---gctatcgttgctgctttcccactcttcttcttttcatcatacatgagcactaataagttcat |
733067 |
T |
 |
| Q |
219 |
tatacctaaccattctagaaaaatatctaaactcccagtct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
733066 |
tatacctaaccattctagaaaaatatctaaactcccagtct |
733026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University