View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19798_low_5 (Length: 342)
Name: NF19798_low_5
Description: NF19798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19798_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 334
Target Start/End: Original strand, 5019121 - 5019456
Alignment:
| Q |
1 |
taatttgaacctttttggatatgaagatgtctcgtggaagatcaaannnnnnn--gacaaaatctcttagatgatcaatgttgttcggtacaattatttt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5019121 |
taatttgaacctttttggatatgaagatgtctcttggaagatcaattttttttttgacaaaatctcttggatgatcaatgttgttcggtacaattatttt |
5019220 |
T |
 |
| Q |
99 |
tgacataatctttgcttcatagaaattttgaaaacaaacatattgtttgattatgactgttgttggaaataaaagaactaatcaaagatcaatttgatgt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5019221 |
tgacataatctttgcttcatagaaattttgaaaccatacatattgtttgattatgactgttgttggaaataaaagaactaatcaaagatcaatttgatgt |
5019320 |
T |
 |
| Q |
199 |
aatcattactccatcaaactgtgttgtcattgcaatattcttccccaaaagtattccactaagcaccattatgcaaccctcatccaccatgtcatggagg |
298 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| | |||| |
|
|
| T |
5019321 |
aatcattactccatcaaactgtattgtcgttgcaatattcttcaccaaaagtattccactaagcaccattatgcaaccctcatccgccatgtcgtagagg |
5019420 |
T |
 |
| Q |
299 |
gttcatatgatacctagtgtgctaggatggtctctg |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
5019421 |
gttcatatgatacctagtgtgctaggatggtctctg |
5019456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University