View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19799_low_10 (Length: 245)
Name: NF19799_low_10
Description: NF19799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19799_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 75 - 202
Target Start/End: Complemental strand, 31885473 - 31885346
Alignment:
| Q |
75 |
cttatgaatttcagtctaatcctgaaaatactgttggagttatgacgatggctgggaagggagttcgagttttgtctacccctaccagtgatttgggcaa |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31885473 |
cttatgaatttcagtctaatcctgaaaatactgttggagttatgactatggctgggaagggagttcgagttttgtctacccctaccagtgatttgggcaa |
31885374 |
T |
|
| Q |
175 |
aatcttgggttgtatgcatggtatgttc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31885373 |
aatcttgggttgtatgcatggtatgttc |
31885346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University