View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19799_low_5 (Length: 439)
Name: NF19799_low_5
Description: NF19799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19799_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 4e-76; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 267 - 426
Target Start/End: Original strand, 45962842 - 45962999
Alignment:
| Q |
267 |
catataaatattatgaaacaagaattagtaagttgcttcaaatgatgtagtagtgtaagcctcacttaagatactaaagttggatcacaccattgaagat |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45962842 |
catataaatattatgaaacaagaattagtaagttgcttcaaatgatgtagtagtgtaagcctcacttaagatactaaagttggatcacaccattgaagat |
45962941 |
T |
 |
| Q |
367 |
gctctaacaaactatgaatgtttcttgtgacaggggaattcttgcttaatttgtgtgttc |
426 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
45962942 |
gctctaacaaactatgaatgtttcttgtgac--gggaattcttgcttaatttgtttgttc |
45962999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 16 - 128
Target Start/End: Original strand, 45962597 - 45962709
Alignment:
| Q |
16 |
aattgctcttatgataatatgaataatgacatctcaacaaccgaaataagttcattgacaacttcaagtagatttagcggagtatgggaacgctttggtc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45962597 |
aattgctcttatgataatatgaataatgacatttcaacaaccgaaagaagttcattgacaacttcaagcagatttagcggagtatgggaacgctttggtc |
45962696 |
T |
 |
| Q |
116 |
atgagtataacaa |
128 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45962697 |
gtgagtataacaa |
45962709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 187 - 224
Target Start/End: Original strand, 45962768 - 45962805
Alignment:
| Q |
187 |
gttcgtgtatttaacgttaattttcaattgttacaatt |
224 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
45962768 |
gttcatgtatttaacgttaattttcaattgttataatt |
45962805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University