View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19799_low_8 (Length: 289)
Name: NF19799_low_8
Description: NF19799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19799_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 9 - 218
Target Start/End: Complemental strand, 38185310 - 38185101
Alignment:
| Q |
9 |
aatgtatccgcacacactttatgccacggaaaagaacaggtcatcacattcatatcttcattactaagaaagttcatcaacattatgaccctcaactaac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38185310 |
aatgtatccgcacacactttatgccacggaaaagaaaaggtcatcacattcatatcttcattactaagaaagttcatcaacattatgaccctcaactaac |
38185211 |
T |
 |
| Q |
109 |
ttgttgccagcttcactttcaactttatatttatatacacacatcaccacttctcatatcacaaatcacattttttcaactaataaagtagaaaactaca |
208 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38185210 |
ttgttgccagcttcactttcaacttaatatttatatacacacatcaccacttctcatatcacatatcacattttttcaactaataaagtagaaaactaca |
38185111 |
T |
 |
| Q |
209 |
ctacattgtg |
218 |
Q |
| |
|
|||||||||| |
|
|
| T |
38185110 |
ctacattgtg |
38185101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 246 - 274
Target Start/End: Complemental strand, 38185067 - 38185039
Alignment:
| Q |
246 |
atggtgttcttttgttttctggtggatca |
274 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38185067 |
atggtgttcttttgttttctggtggatca |
38185039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University