View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1979_low_4 (Length: 246)
Name: NF1979_low_4
Description: NF1979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1979_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 39 - 229
Target Start/End: Original strand, 37352986 - 37353176
Alignment:
| Q |
39 |
ttctagtaaaggaagttggggtaagaaaatgacgggaaaacctatgaatggtgttgggaagagacgtgttccaccttctccacatgagttacactataaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37352986 |
ttctagtaaaggaagttggggtaagaaaatgacgggaaaacctatgaatggtgttgggaagagacgtgttccaccttctccacatgagttacactataaa |
37353085 |
T |
 |
| Q |
139 |
gcaaatagggctcaagctgaagagttgaggagaaagacgtttttgccttatagacaaggtctgcttggttgtttgggatttagttctaagg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37353086 |
gcaaatagggctcaagctgaagagttgaggagaaagacgtttttgccttatagacaaggtctgcttggttgtttgggatttagttctaagg |
37353176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University