View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1979_low_5 (Length: 203)
Name: NF1979_low_5
Description: NF1979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1979_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 21 - 180
Target Start/End: Original strand, 2520708 - 2520866
Alignment:
| Q |
21 |
ctgaaatgaaagggatggtaagannnnnnnagtagcaaatacatttttgtgatgtctactccacttgtgtttcaaattctggtttcttttgtagctcata |
120 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2520708 |
ctgaaatgaaagggatggtaag-tttttttagtagcaaatacatttttgtgatgtctactccacttgtgtttcaaattctggtttcttttgtagctcata |
2520806 |
T |
|
| Q |
121 |
gatcctccgttcgacatatttgaagaggatattcgccataggaatgagtcgccatttgcg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2520807 |
gatcctccgttcgacatatttgaagaggatattcgccataggaatgagtcgccatttgcg |
2520866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University