View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19800_high_18 (Length: 349)
Name: NF19800_high_18
Description: NF19800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19800_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 15 - 184
Target Start/End: Complemental strand, 33613304 - 33613135
Alignment:
| Q |
15 |
tcttacaaatgaggacaccattccacgtggtgcttatgacttggtgggaaatagtaattggaaaggtagtatattttatgttgtagggtcgaaaaattta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33613304 |
tcttacaaatgaggacaccattccacgtggtgcttatgacttggtgttaaatagtaattggaaaggtagtatattttatgttgtagggtcgaaaaattta |
33613205 |
T |
 |
| Q |
115 |
tcacttttttaaaaatgtattcataaataaattttgcatttaagaatctttgttcgagacaaaagtttat |
184 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33613204 |
tcactttttttaaaatgtattcataaataaattttgcatttaagaatctttgttggagacaaaagtttat |
33613135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 306 - 334
Target Start/End: Complemental strand, 33613011 - 33612983
Alignment:
| Q |
306 |
tgacaatataacttgaacttagaccttat |
334 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33613011 |
tgacaatataacttgaacttagaccttat |
33612983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University