View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19800_high_20 (Length: 284)
Name: NF19800_high_20
Description: NF19800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19800_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 5e-34; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 101 - 174
Target Start/End: Original strand, 4608379 - 4608452
Alignment:
| Q |
101 |
gagcctctctctgataactttctgtgacatctttttgtcatgtaatacagttcttcacgagctagtgtcagaag |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608379 |
gagcctctctctgataactttctgtgacatctttttgtcatgtaatacagttcttcacgagctagtgtcagaag |
4608452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 4608279 - 4608315
Alignment:
| Q |
1 |
agattttgaagttttatgcaagtaatattctaatggg |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608279 |
agattttgaagttttatgcaagtaatattctaatggg |
4608315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 266
Target Start/End: Original strand, 4608512 - 4608544
Alignment:
| Q |
234 |
ccaccgtttgtctattgagcacttatctggtat |
266 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
4608512 |
ccaccgtttgtctattgagcacttatttggtat |
4608544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University