View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19800_high_24 (Length: 256)
Name: NF19800_high_24
Description: NF19800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19800_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 18 - 108
Target Start/End: Original strand, 33612264 - 33612354
Alignment:
| Q |
18 |
atgtaagattatttttggtgtataaggacgataacattcaacgtgtaattaacatgttagaagaaattgtttaacatatattgcaactatg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33612264 |
atgtaagattatttttggtgtataaggacgataacattcaacgtgtaattaacatgttagaagaaattgtttaacatatattacaactatg |
33612354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 170 - 256
Target Start/End: Original strand, 33612416 - 33612502
Alignment:
| Q |
170 |
caactttaatcataactatggttaaaaatttacatgtgaatgtttatgatttcttaacgggtacaacttttgctttattttttactt |
256 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33612416 |
caactttaatcatatctattgttaaaaatttacatgtgaatgtttatgatttcttaacgggtacaacttttgctttattttttactt |
33612502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University