View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19800_low_26 (Length: 261)
Name: NF19800_low_26
Description: NF19800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19800_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 115 - 243
Target Start/End: Original strand, 16276593 - 16276721
Alignment:
| Q |
115 |
aaataatccaaaggctttacataatgaagttggaagcttaagactcatcttacagaggtttcagggcactattactaatatgaatgaagaggtaaatgga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16276593 |
aaataatccaaaggctttacataatgaagttggaagcttaagactcatcttacagaggtttcagggcactattactaatatgaatgaagaggtaaatgga |
16276692 |
T |
|
| Q |
215 |
tttttcttaatctttttctaggtagaagg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16276693 |
tttttcttaatctttttctaggtagaagg |
16276721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 55
Target Start/End: Original strand, 16276488 - 16276533
Alignment:
| Q |
10 |
gcagagatacataatttaatttcagacaaagaggtatcatattcaa |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16276488 |
gcagagatacataatttaatttcagacaaagaggtatcatattcaa |
16276533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University