View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19800_low_27 (Length: 256)

Name: NF19800_low_27
Description: NF19800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19800_low_27
NF19800_low_27
[»] chr4 (2 HSPs)
chr4 (18-108)||(33612264-33612354)
chr4 (170-256)||(33612416-33612502)


Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 18 - 108
Target Start/End: Original strand, 33612264 - 33612354
Alignment:
18 atgtaagattatttttggtgtataaggacgataacattcaacgtgtaattaacatgttagaagaaattgtttaacatatattgcaactatg 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
33612264 atgtaagattatttttggtgtataaggacgataacattcaacgtgtaattaacatgttagaagaaattgtttaacatatattacaactatg 33612354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 170 - 256
Target Start/End: Original strand, 33612416 - 33612502
Alignment:
170 caactttaatcataactatggttaaaaatttacatgtgaatgtttatgatttcttaacgggtacaacttttgctttattttttactt 256  Q
    |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33612416 caactttaatcatatctattgttaaaaatttacatgtgaatgtttatgatttcttaacgggtacaacttttgctttattttttactt 33612502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University