View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19800_low_30 (Length: 240)
Name: NF19800_low_30
Description: NF19800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19800_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 35354340 - 35354116
Alignment:
| Q |
1 |
tattttgtgtgtgtttattctctgattcttaatggaaagaaatcctaataatctaaagtttagttgaaagataagtaaattttc-atctagaattgttcn |
99 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
35354340 |
tattttgtgtgtgtttattctccgattcttgatggaaagaaatcctagtaatctaaagtttaattgaaagataagtaaattttttatctagaattgttca |
35354241 |
T |
 |
| Q |
100 |
nnnnnn-gctgcaatatcataactctaaaatttgttatatagcttatttttgtttgaaagggcttatttgtgtctatcttatgtgtatcaatcataagat |
198 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35354240 |
aaaaaaagctgcaatatcataactctaaaaattgttatataacttatttttgtttgaaagggcttat----gtctatcttatgtgtatcaatcataagat |
35354145 |
T |
 |
| Q |
199 |
attggattctgtcgctttcacatatattc |
227 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
35354144 |
attggattctgtcgctttcgcatatattc |
35354116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University