View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19800_low_31 (Length: 240)
Name: NF19800_low_31
Description: NF19800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19800_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 23 - 224
Target Start/End: Complemental strand, 2990403 - 2990202
Alignment:
| Q |
23 |
ttcgagacaaaccgaaatgcagcttggaattgctaaattcaaaagcgatttccatcctttgaaacaagaagaggaaattccactccatgttttcttgtgt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2990403 |
ttcgagacaaaccgaaatgcagcttggaattgctaaattcaaaagcgatttccatcctttgaaacaagcagaggaaattccactccatgttttcttgtgt |
2990304 |
T |
 |
| Q |
123 |
gttccagaaacccaaatgtaaataatcaaggaaacaacgaggttgaaattcgtccaaacggaacctaaagctattcctcttattcctaattgaagaacat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2990303 |
gttccagaaacccaaatgtaaataatcaaggaaacaacgaggttgaaattcgtccaaacggaacctaaagcgattcctcttattcctaattgaagaacat |
2990204 |
T |
 |
| Q |
223 |
tg |
224 |
Q |
| |
|
|| |
|
|
| T |
2990203 |
tg |
2990202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University