View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19803_high_17 (Length: 324)
Name: NF19803_high_17
Description: NF19803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19803_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 16 - 180
Target Start/End: Complemental strand, 6640751 - 6640596
Alignment:
| Q |
16 |
atgaaggatgagatggatcttaacagaggtagatgtgactgacattgtgaaaaagactccataaattgctgaaactgctgaaacacgactcctcttctga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6640751 |
atgaaggatgagatggatcttaacagaggtagatgtgactgacattgtgaaaaagactccataaattgctgaaac---------acgactcctcttctga |
6640661 |
T |
|
| Q |
116 |
tgcatgaaaaagctcctcatgacggcatcatcaagcatgtaagataatttatccgtctataagac |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6640660 |
tgcatgaaaaagctcctcatgacggcatcatcaagcatgtaagataatttatccgtctataagac |
6640596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 245 - 305
Target Start/End: Complemental strand, 6640531 - 6640471
Alignment:
| Q |
245 |
gaagaaacttggaaaactctagcattcataagccttgttgcatcgggtatgagctctttca |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6640531 |
gaagaaacttggaaaactctagcattcataagccttgttgcatcgggtatgagctctttca |
6640471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 83
Target Start/End: Original strand, 8730411 - 8730453
Alignment:
| Q |
41 |
gaggtagatgtgactgacattgtgaaaaagactccataaattg |
83 |
Q |
| |
|
||||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
8730411 |
gaggtagatgtgaatgacctggtgaaaaagactccataaattg |
8730453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University