View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19803_low_19 (Length: 322)
Name: NF19803_low_19
Description: NF19803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19803_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 23 - 303
Target Start/End: Complemental strand, 26607182 - 26606902
Alignment:
| Q |
23 |
gttgtcaacttccacttagctttgactaattctaacacacccatgatctttgtggactcgagaaagactcacctgtctcatattcgactactttttattt |
122 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26607182 |
gttgtcaacttccatttagctttgactaattctaacacactcatgatctttgtggactcgagaaagactcacttgtctcatattcgactactttttattt |
26607083 |
T |
 |
| Q |
123 |
gactaaccttcatttggttgaaggaacttcaaatgaccttaaattcggtcgtttgtcattatcagctaacaacttatttatttttaaatgtaaacaagtg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26607082 |
gactaaccttcatttggttgaaggaacttcaaatgaccttaaattcggtcgtttgtcattatcagctaacaacttatttatttttaaatgtaaacaagtg |
26606983 |
T |
 |
| Q |
223 |
tccacctacgttgcattatttgatagcttgagttgggagataatgtgatgtaaacaacacatgaacaatgctatcattgta |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26606982 |
tccacctacgttgcattatttgatagcttgagttgggagataatgtgatgtaaacaacacatgaacaatgctatgattgta |
26606902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University