View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19803_low_30 (Length: 223)
Name: NF19803_low_30
Description: NF19803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19803_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 16 - 205
Target Start/End: Complemental strand, 3934468 - 3934278
Alignment:
| Q |
16 |
aatattacaaacagtaaatatcctcttgttttcaatagatgtcacagttcaacnnnnnnnatgctgttaaattagtcatatggttaagtaaatatcactt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3934468 |
aatattacaaacagtaaatatcctcttgttttcaatagatgccacagttcaactttttttatgttgttaaattagtcatatggttaagtaaatatcactt |
3934369 |
T |
|
| Q |
116 |
tcattcttgtaaaataaataatataatcataactaa-ttttgtttagccactcatccttatattgtttaatatataaatcattgatggaat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3934368 |
tcattcttgtaaaataaataatataatcataactaatttttgtttagccactcatccttatattgtttaatatataaatcattgatggaat |
3934278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University