View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19803_low_35 (Length: 202)
Name: NF19803_low_35
Description: NF19803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19803_low_35 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 5806445 - 5806646
Alignment:
| Q |
1 |
tacctggcaatgcataaataggtggtcttgtgattccatgtcattgtggcagtggcacagcagacaatcagcatccggagtacctcctttttgttccagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
5806445 |
tacctggcaatgcataaataggtggtcttgtgattccatgtcattgtggcagtggcacagcagacaatcagcatccggagcaactcctttttgttccagc |
5806544 |
T |
|
| Q |
101 |
ctgcatcttgtgggaagaatatgtttggaaattctccacatgaaattcttaatcctttgtggtgctcgaatcttccagatatccttccaaatactgttgt |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5806545 |
cagcatcttgtgggaagaatatgtttggaaactctccacatgaaattcttaatcctttgtggtgctcgaatcttccagatatccttccaaataccgttgt |
5806644 |
T |
|
| Q |
201 |
tc |
202 |
Q |
| |
|
|| |
|
|
| T |
5806645 |
tc |
5806646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University