View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19804_high_14 (Length: 277)
Name: NF19804_high_14
Description: NF19804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19804_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 22 - 256
Target Start/End: Original strand, 24743801 - 24744035
Alignment:
| Q |
22 |
ttaggacctgaatgtaaggtgtgagaagagaaagctgcaaagcccaaccaaactgaacaccagcagcaacggtgcaactaagaacaagatgcgttaacga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24743801 |
ttaggacctgaatgtaaggtgtgagaagagaaagctgcaaagcccaaccaaactgaacaccagcagcaacggtgcaactaagaacaagatgcgttaacga |
24743900 |
T |
 |
| Q |
122 |
agcattattcttcgtcggtaatggatctccgcgcggcggtgaattaagatcgatccgatgccgaggttcatcaccgtcgccgtcgatgccgacgagttcg |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
24743901 |
agcattattcttcgtcggtaattgatctccacgcggcggtgaattaagatcgatccgatgccgaggttcatctccgtctccgtcgatgccgacgagttcg |
24744000 |
T |
 |
| Q |
222 |
acttccgcggtggaagaatcgtttcttagattctt |
256 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
24744001 |
acttccgcggcggaagaatcgtttcttagattctt |
24744035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University