View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19804_low_15 (Length: 280)
Name: NF19804_low_15
Description: NF19804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19804_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 36 - 222
Target Start/End: Complemental strand, 24743712 - 24743527
Alignment:
| Q |
36 |
tataaagcttgttatgtttattgaatgtgatgagattaattcctcagattagtgtctcgttgagtttgagttggatactgagtttccaaaaagaaaagta |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||||||| |||| |||||||||||||||||| || |
|
|
| T |
24743712 |
tataaagcttgttatgtttattgaatgtgatgagattaattcctcaaagtagtgtctcattgagtttgagtccaataccgagtttccaaaaagaaaa-ta |
24743614 |
T |
 |
| Q |
136 |
gtcattttgatctctgaatgtgtcagacgcgttgtcattatagtaagaaaaacacatttgacaattaaaatgactaactaaagacgc |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
24743613 |
gtcattttaatctctgaatgtgtcagacgcgttgtcattatcgtaagagaaacacatttgacgattaaaatgactaaccaaagacgc |
24743527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 24743780 - 24743744
Alignment:
| Q |
1 |
ttttgattagatccgaatttttgttagaattgcgata |
37 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24743780 |
ttttgtttagatccgaatttttgttagaattgcgata |
24743744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University