View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19804_low_17 (Length: 276)
Name: NF19804_low_17
Description: NF19804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19804_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 261
Target Start/End: Complemental strand, 40014010 - 40013764
Alignment:
| Q |
17 |
tagtaaaaattagtcatcggtaaagttgatgaatactttagaatgatagtagtagcatcaaagtcttgatggcaatctatttgttcataattgagagtac |
116 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40014010 |
tagtgaaaattagtcatcaataaagttgatgaatactttagaatgatagtagtagcatcaaagtcttgatggcaatctatttgttcataattgagagtac |
40013911 |
T |
 |
| Q |
117 |
attataacttggcaaaacaataagaaaacc-tgagagtttaatcgag-nnnnnnnnntgagagccaaactatattattattttagagtcactatcagagg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40013910 |
attataacttggcaaaacaataagaaaaccttgagagtttaatcgagaaaaaaaaaatgagagccaaactattttattattttagagtcactatcagagg |
40013811 |
T |
 |
| Q |
215 |
ctattaaattgctctttttattgtgtaatccaatcaagcaagtaact |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40013810 |
ctattaaattgctctttttattgtgtaatccaatcaagcaagtaact |
40013764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University