View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19805_high_13 (Length: 268)
Name: NF19805_high_13
Description: NF19805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19805_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 19751619 - 19751370
Alignment:
| Q |
1 |
cggacattaaccaaattatttaatgttggttgggatattttttcatgtatagcagtgaattctcaccatgtttgtcaacgagggatatggtttcaggttc |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19751619 |
cggacattaaccaaattatttagtgttggttgggatattttttcatgcatagcagtgaattctcaccatgtttgtcaacgagggatatggtttcaggttc |
19751520 |
T |
|
| Q |
101 |
tgttttgtgggaggttgaggaattactttgaattttgtggtgattggtgttaaacctgcaaaactgtaactcggtattagttaacttgagcattaagcta |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
19751519 |
tgttttgtaggaggttgaggaattactttgaattttgtggtgattgttgttaaacctgcaaaactgtaactcggtattagttaacttgagc-tttagcta |
19751421 |
T |
|
| Q |
201 |
cactattactatagtgtatcgtacataaagtgagtaatctaaccatatagt |
251 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
19751420 |
cactattactatagtgtatggtacatagagtgagtaatctaaccatatagt |
19751370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University