View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19805_low_12 (Length: 366)
Name: NF19805_low_12
Description: NF19805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19805_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 70 - 288
Target Start/End: Complemental strand, 41250589 - 41250375
Alignment:
| Q |
70 |
tgaagttggtggatttaataatcttggtataactttgaatgataatcataattatctctacacttgaatgttggtggtaataacagaaatacaatgaata |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41250589 |
tgaagttggtggatttaataatcttggtataactttgaatgataatcataattatctctacacttgaatgttgttggtaataacagaaatacaatgaata |
41250490 |
T |
|
| Q |
170 |
attaatgtttaggtttggaaaatgtgtgattcaatagtggatccaattgcttcttgaagatgaccttttatggaattagttttagttctagtgcattgat |
269 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41250489 |
at----gtttaggtttggaaaatgtgtgattcaatagtggatccaattgcttcttgaagatgaccttttatggaattagttttagttctagtgcattgat |
41250394 |
T |
|
| Q |
270 |
atctgatagctaaatctta |
288 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41250393 |
atctgatagctaaatctta |
41250375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 41251900 - 41251822
Alignment:
| Q |
1 |
catagggttgatgttaggaagaacaccaccacgaacaatggtaactccaccaaacaattatcagggtgatgaagttggt |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41251900 |
catagggttgatgttaggaagaacaccaccacgagcaatggtaactccaccaaacaattatcagggtgatgaagttggt |
41251822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University