View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19805_low_15 (Length: 306)
Name: NF19805_low_15
Description: NF19805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19805_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 5113361 - 5113186
Alignment:
| Q |
1 |
aaaactatgcattgcacaaaaaggaagaaagataatatttattcttgccttcgtataggcaggaacttgtccgccaagataaatttgcggtaaaactctg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5113361 |
aaaactatgcattgcacgaaaaggaagaaagataatatttattcatgccttcgtataggcaggaacttgtccgccaagataaatttgcggtaaaactctg |
5113262 |
T |
|
| Q |
101 |
catcaagctctttaattcttttccttatcaaaaccagaaagcctcttgtcattcaggaataatcaaacccctaccagtg |
179 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5113261 |
catcaagctctttaattcttt---aattcaaaaccagaaatcctcttgtcattcaggaataatcaaacccctaccagtg |
5113186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 197 - 271
Target Start/End: Complemental strand, 5113196 - 5113122
Alignment:
| Q |
197 |
ccctaccagtgctccctgaaaaccatcacaattattcaaatcaaccattnnnnnnnccaacaatatgtattgcga |
271 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5113196 |
ccctaccagtgctccctgaaaatcatcacaattattcaaatcaaccattaaaaaaaccaacaatatgtattgcga |
5113122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University