View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19805_low_25 (Length: 244)
Name: NF19805_low_25
Description: NF19805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19805_low_25 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 39 - 244
Target Start/End: Complemental strand, 55169463 - 55169274
Alignment:
| Q |
39 |
atattcattcactctgaatcaatgaagcaaagaagtgagtgatcatcaaatatagatagaattgatcgatatgggaaggtcctcttgctgtgagaaaggt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55169463 |
atattcattcactctgaatcaatgaagcaaagaagtgagtgatcatcaaatatagatagaattgatcgatatgggaaggtccccttgctgtgagaaaggt |
55169364 |
T |
 |
| Q |
139 |
cacataaacaaaggagcatggagcaaagaagaagatgagcggctgatagcttatattagagctcacggtgagggatgctggcgctctctccgaaaagccg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55169363 |
cacataaacaaaggagcatggagcaaagaagaagatgagcggct----------------gctcacggtgagggatgctggcgctctctcccaaaagccg |
55169280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University