View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19805_low_7 (Length: 393)
Name: NF19805_low_7
Description: NF19805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19805_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 8e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 236 - 376
Target Start/End: Complemental strand, 16819717 - 16819577
Alignment:
| Q |
236 |
ctgaaaccgcttatcaaccacatagaacgttcatagccaccccgtttctcacggacacccatgatatcaataaagtcacccataatacaccatgggagcg |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16819717 |
ctgaaaccgcttatcaaccacatagaacgttcatagccaccccgtttctcacggacacccatgatatcaataaagtcacccataatacaccatgggagcg |
16819618 |
T |
 |
| Q |
336 |
aaatactttgtgacatattatgcaagaaatcccatgaggca |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16819617 |
aaatactttgtgacatattatgcaagaaatcccatgaggca |
16819577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University