View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19806_high_11 (Length: 213)
Name: NF19806_high_11
Description: NF19806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19806_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 29266794 - 29266973
Alignment:
| Q |
17 |
taggtgataaacaacaattttgaaataaggttcttgaagttaaatatggaggtggggtctaaaatgttgtcaatttgagaagtttgtgtcaaattccaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||| |
|
|
| T |
29266794 |
taggtgataaacaacaattttgaaataaggttcttgaaattaaatatggaggtggggtctaaaatgttgtcaacttgataagtttgtgtcaaattgtaga |
29266893 |
T |
|
| Q |
117 |
ctcatctacggggtggaaggtcatacactctttggggattatttacggagttggcatatattagtttctatgtgggtttt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29266894 |
ctcatctacggggtggaaggtcatacactctttggggattatttacggagttggcatatattagtttctatgtgggtttt |
29266973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University