View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19806_high_8 (Length: 256)
Name: NF19806_high_8
Description: NF19806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19806_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 136 - 236
Target Start/End: Original strand, 11814897 - 11814996
Alignment:
| Q |
136 |
acgttggaaaatacaaatgtgtagtatgtttgtaacttttgcaagccaaatgtttattatatagatataaaatacagttatagatctttatttaggcgtt |
235 |
Q |
| |
|
||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11814897 |
acgttggaaaataaacttgtgtagtatctttgtaacttttgcaagccaaatgtttattatat-gatataaaatacagttatagatttttatttaggcgtt |
11814995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University