View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19806_low_11 (Length: 224)
Name: NF19806_low_11
Description: NF19806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19806_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 9 - 211
Target Start/End: Original strand, 45052637 - 45052833
Alignment:
| Q |
9 |
tatcaaaggaagaaaactagtttgacatgaataaattaatcctatagttcttgcaagacttgtaaaatctaacttgacatgattagatcgtctttgcctc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45052637 |
tatcaaaggaagaaaactagtttgacatgaataaattaatcctatagttcttgcaagacttgtaaaatctaacttgatatgattagatcgtctttgcctc |
45052736 |
T |
 |
| Q |
109 |
cgcaaaaatctaaatttatgattcttccaagatttatgcgtatgcggatgcatgtcagaatagtttttgtcagtttcattcattcgaaatattgaaagta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45052737 |
cgcaaaaatctaaatttatgattcttccaagatt------tatgcggatgcatgtcagaatagtttttgtcagtttcattcattcgaaatattgaaagta |
45052830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University