View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19806_low_12 (Length: 213)

Name: NF19806_low_12
Description: NF19806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19806_low_12
NF19806_low_12
[»] chr3 (1 HSPs)
chr3 (17-196)||(29266794-29266973)


Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 29266794 - 29266973
Alignment:
17 taggtgataaacaacaattttgaaataaggttcttgaagttaaatatggaggtggggtctaaaatgttgtcaatttgagaagtttgtgtcaaattccaga 116  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||  |||    
29266794 taggtgataaacaacaattttgaaataaggttcttgaaattaaatatggaggtggggtctaaaatgttgtcaacttgataagtttgtgtcaaattgtaga 29266893  T
117 ctcatctacggggtggaaggtcatacactctttggggattatttacggagttggcatatattagtttctatgtgggtttt 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29266894 ctcatctacggggtggaaggtcatacactctttggggattatttacggagttggcatatattagtttctatgtgggtttt 29266973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University