View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19806_low_14 (Length: 203)
Name: NF19806_low_14
Description: NF19806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19806_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 187
Target Start/End: Complemental strand, 40711450 - 40711279
Alignment:
| Q |
16 |
cagttactagctggcctttgtaatcatataaagtttcacaaatcacatagttgggattttgaatgcttgagattgatattgttctcacaatatctcctag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40711450 |
cagttactagctggcctttgtaatcatataaagtttcacaaatcacatagttgggattttgaatgcttgagattgatattgttctcacaatatctcctag |
40711351 |
T |
|
| Q |
116 |
agccatataatttagtatttaggtgatacgaaatctctttcatattttgcactttttattaattctgttata |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40711350 |
agccatataatttagtatttaggtgatacgaaatctctttcatattttgcactttttattaattctgttata |
40711279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 172
Target Start/End: Original strand, 40675317 - 40675363
Alignment:
| Q |
126 |
tttagtatttaggtgatacgaaatctctttcatattttgcacttttt |
172 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
40675317 |
tttagtatttaggtgaaacgaaatctcttcaatattttgcacctttt |
40675363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University