View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19808_low_21 (Length: 227)
Name: NF19808_low_21
Description: NF19808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19808_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 3041345 - 3041158
Alignment:
| Q |
17 |
agaagaatcaagttgtgggatggcctccggtgtgttcgtaccggaagaagaacatgaatgaaggttcaaaaatgtacatgaaggttagcatggatggagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3041345 |
agaagaatcaagttgtgggatggcctccggtgtgttcgtaccggaagaagaatatgaatgaaggttcaaaaatgtacatgaaggttagcatggatggagc |
3041246 |
T |
|
| Q |
117 |
tccttacttgcgtaagattgatcttggtttgcataagggatacttggagttagctttggctttggagaagctctttggttgttgtgga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3041245 |
tccttacttgcgtaagattgatcttggtttgcataagggatacttggagttagctttggctttggagaagctctttggttgttgtgga |
3041158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University